ClinVar Genomic variation as it relates to human health
NM_000173.7(GP1BA):c.1272GGAGCCCACCTCAGAGCCCGCCCCCAGCCCGACCACCCC[3] (p.Thr453_Pro454insSerGluProAlaProSerProThrThrProGluProThrSerGluProAlaProSerProThrThrProGluProThr)
Germline
Classification
(2)
Benign; risk factor
no assertion criteria provided
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation | Variation Viewer | Related variants | ||
---|---|---|---|---|---|---|
HI score | TS score | Within gene | All | |||
GP1BA | - | - |
GRCh38 GRCh37 |
158 | 212 |
Conditions - Germline
Condition | Classification
(# of submissions) |
Review status | Last evaluated | Variation/condition record |
---|---|---|---|---|
risk factor (1) |
|
Jan 1, 2004 | RCV000004369.2 | |
Benign (1) |
|
Jan 1, 2004 | RCV000004368.2 |
Citations for germline classification of this variant
HelpText-mined citations for this variant ...
HelpRecord last updated Dec 25, 2023
NCBI staff chose to represent this polymorphism as 3 copies of the repeat (the B allele). This copy number is the same as represented in NM_000173.7 and NG_008767.2.